Review



hek293 human embryonic kidney cell line  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95

    Structured Review

    ATCC hek293 human embryonic kidney cell line
    Hek293 Human Embryonic Kidney Cell Line, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 85 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+human+hek293+atcc+crl/HEK+293+STF%3B+Embryonic+Kidney%3B+Human/pm41683879-440-1-11
    Average 95 stars, based on 85 article reviews
    hek293 human embryonic kidney cell line - by Bioz Stars, 2026-09
    95/100 stars

    Images

    Related Articles

    other:

    Article Title: Context-dependent inhibitory roles of RhoA in 3D invasive cell migration within the extracellular matrix.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Gelatin from pig skin, Oregon green (OG)488 conjugate Thermo Fisher Scientific Cat# G13186 Porcine skin gelatin Sigma-Aldrich Cat# G2500 50% Glutaraldehyde Sigma-Aldrich Cat# 340855 Sodium borohydride powder Sigma-Aldrich Cat# 452882 Formaldehyde Fisher chemical Cat# F79 Hydrogen peroxide Sigma-Aldrich Cat# H1009 DAB substrate Abcam Cat# ab64238 Polybrene Infection/Transfection Reagent MilliporeSigma Cat# TR-1003-G Tamoxifen Sigma-Aldrich Cat# T5648 Sodium Chloride solution Sigma-Aldrich Cat# S8776 Critical commercial assays CryoSelect 24-Well Cell Invasion Assay Cell Biolabs, Inc Cat# CBA-110 RhoA/Rac1/Cdc42 G-LISA Activation Kit Cytoskeleton Inc Cat# BK135 GeneArt CRISPR Nuclease (OFP Reporter) vector kit Thermo Fisher Scientific Cat# A21174 Experimental models: Cell lines Human HEK293 ATCC CRL-1573 Human MDA-MB-231 ATCC HTB-26 Human PANC1 ATCC CRL-1469 RHOA-KO HEK293 cells This study N/A RHOA-KO MDA-MB-231 cells This study N/A Experimental models: Organisms/strains KPC mice Jackson Laboratory Strain# 032429 RHOA flox/flox mice Melendez, J. et al. 32 RHOA flox/flox mice Oligonucleotides CRISPR KO target sequence; #1 CCAGAGGTGTATGTGCCCACAGT This study N/A CRISPR KO target sequence; #2 CGGAAGAAACTGGTGATTGT This study N/A siRNA: Negative control Thermo Fisher Scientific Cat# 4390843 siRHOA s758 Thermo Fisher Scientific Assay ID: s758 siRHOA s759 Thermo Fisher Scientific Assay ID: s759 shRNA targeting sequence: scramble: CCTAAGGTTAAGTCGCCCTCG Addgene #1864 shRNA targeting sequence: RHOA: TGGAAAGACATGCTTGCTCAT Sigma-Aldrich TRCN0000047711 Recombinant DNA pLKO.1 scrambled shRNA This study N/A pLKO.1 RHOAKO shRNA This study N/A pHR-CMV8.2ΔR Addgene #8455 pCMV-VSVG Addgene #8454 Software and algorithms FIJI 1.0 NIH https://imagej.net/software/fiji/downloads Prism 9.3.1 GraphPad https://www.graphpad.com/features Cell Reports 44, 116649, December 23, 2025 17 supplemented with 10% fetal bovine serum (FBS).

    Imaging:

    Article Title: DNA-initiated epigenetic cascades driven by C9orf72 hexanucleotide repeat.
    Article Snippet: In brief This study has revealed pathogenic cascades initiated by C9orf72 hexanucleotide repeat DNA that influence genomic structures and gene expression.. DAXX, a G4C2 repeat DNA-binding protein, regulates stress-dependent C9orf72 induction and global gene expression through chromatin remodeling and epigenetic changes as a key player mediating C9orf72 haploinsufficiency and DNA-dependent gain-of-function toxicities.

    SYBR Green Assay:

    Article Title: DNA-initiated epigenetic cascades driven by C9orf72 hexanucleotide repeat.
    Article Snippet: In brief This study has revealed pathogenic cascades initiated by C9orf72 hexanucleotide repeat DNA that influence genomic structures and gene expression.. DAXX, a G4C2 repeat DNA-binding protein, regulates stress-dependent C9orf72 induction and global gene expression through chromatin remodeling and epigenetic changes as a key player mediating C9orf72 haploinsufficiency and DNA-dependent gain-of-function toxicities.

    HiChIP:

    Article Title: DNA-initiated epigenetic cascades driven by C9orf72 hexanucleotide repeat.
    Article Snippet: In brief This study has revealed pathogenic cascades initiated by C9orf72 hexanucleotide repeat DNA that influence genomic structures and gene expression.. DAXX, a G4C2 repeat DNA-binding protein, regulates stress-dependent C9orf72 induction and global gene expression through chromatin remodeling and epigenetic changes as a key player mediating C9orf72 haploinsufficiency and DNA-dependent gain-of-function toxicities.

    Chromatin Immunoprecipitation:

    Article Title: DNA-initiated epigenetic cascades driven by C9orf72 hexanucleotide repeat.
    Article Snippet: In brief This study has revealed pathogenic cascades initiated by C9orf72 hexanucleotide repeat DNA that influence genomic structures and gene expression.. DAXX, a G4C2 repeat DNA-binding protein, regulates stress-dependent C9orf72 induction and global gene expression through chromatin remodeling and epigenetic changes as a key player mediating C9orf72 haploinsufficiency and DNA-dependent gain-of-function toxicities.

    RNA Sequencing:

    Article Title: DNA-initiated epigenetic cascades driven by C9orf72 hexanucleotide repeat.
    Article Snippet: In brief This study has revealed pathogenic cascades initiated by C9orf72 hexanucleotide repeat DNA that influence genomic structures and gene expression.. DAXX, a G4C2 repeat DNA-binding protein, regulates stress-dependent C9orf72 induction and global gene expression through chromatin remodeling and epigenetic changes as a key player mediating C9orf72 haploinsufficiency and DNA-dependent gain-of-function toxicities.

    Recombinant:

    Article Title: DNA-initiated epigenetic cascades driven by C9orf72 hexanucleotide repeat.
    Article Snippet: In brief This study has revealed pathogenic cascades initiated by C9orf72 hexanucleotide repeat DNA that influence genomic structures and gene expression.. DAXX, a G4C2 repeat DNA-binding protein, regulates stress-dependent C9orf72 induction and global gene expression through chromatin remodeling and epigenetic changes as a key player mediating C9orf72 haploinsufficiency and DNA-dependent gain-of-function toxicities.

    Plasmid Preparation:

    Article Title: DNA-initiated epigenetic cascades driven by C9orf72 hexanucleotide repeat.
    Article Snippet: In brief This study has revealed pathogenic cascades initiated by C9orf72 hexanucleotide repeat DNA that influence genomic structures and gene expression.. DAXX, a G4C2 repeat DNA-binding protein, regulates stress-dependent C9orf72 induction and global gene expression through chromatin remodeling and epigenetic changes as a key player mediating C9orf72 haploinsufficiency and DNA-dependent gain-of-function toxicities.

    shRNA:

    Article Title: DNA-initiated epigenetic cascades driven by C9orf72 hexanucleotide repeat.
    Article Snippet: In brief This study has revealed pathogenic cascades initiated by C9orf72 hexanucleotide repeat DNA that influence genomic structures and gene expression.. DAXX, a G4C2 repeat DNA-binding protein, regulates stress-dependent C9orf72 induction and global gene expression through chromatin remodeling and epigenetic changes as a key player mediating C9orf72 haploinsufficiency and DNA-dependent gain-of-function toxicities.

    Software:

    Article Title: DNA-initiated epigenetic cascades driven by C9orf72 hexanucleotide repeat.
    Article Snippet: In brief This study has revealed pathogenic cascades initiated by C9orf72 hexanucleotide repeat DNA that influence genomic structures and gene expression.. DAXX, a G4C2 repeat DNA-binding protein, regulates stress-dependent C9orf72 induction and global gene expression through chromatin remodeling and epigenetic changes as a key player mediating C9orf72 haploinsufficiency and DNA-dependent gain-of-function toxicities.



    Similar Products

    95
    ATCC hek293 human embryonic kidney cell line
    Hek293 Human Embryonic Kidney Cell Line, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+human+hek293+atcc+crl/HEK+293+STF%3B+Embryonic+Kidney%3B+Human/pm41683879-440-1-11
    Average 95 stars, based on 1 article reviews
    hek293 human embryonic kidney cell line - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    95
    ATCC human embryonic kidney 293 hek293 cell lines
    Human Embryonic Kidney 293 Hek293 Cell Lines, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+human+hek293+atcc+crl/HEK+293+STF%3B+Embryonic+Kidney%3B+Human/10__20517_slash_evcna__2025__39-54-14-24
    Average 95 stars, based on 1 article reviews
    human embryonic kidney 293 hek293 cell lines - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    99
    ATCC cell lines human embryonic kidney hek293s gnti cell line atcc crl
    Cell Lines Human Embryonic Kidney Hek293s Gnti Cell Line Atcc Crl, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+human+hek293+atcc+crl/HEK293S+GnTI/pm41442279-214-182-190
    Average 99 stars, based on 1 article reviews
    cell lines human embryonic kidney hek293s gnti cell line atcc crl - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    ATCC cell lines hek293 cells atcc crl 1573
    Cell Lines Hek293 Cells Atcc Crl 1573, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+human+hek293+atcc+crl/293%3B+Embryonic+Kidney%3B+Human/pm41418776-176-296-300
    Average 99 stars, based on 1 article reviews
    cell lines hek293 cells atcc crl 1573 - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    ATCC cell lines human hek293 atcc crl
    Cell Lines Human Hek293 Atcc Crl, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+human+hek293+atcc+crl/293/pm41359424-237-101-105
    Average 99 stars, based on 1 article reviews
    cell lines human hek293 atcc crl - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    ATCC cell lines hek293 atcc crl
    Cell Lines Hek293 Atcc Crl, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+human+hek293+atcc+crl/293%3B+Embryonic+Kidney%3B+Human/pm41240913-153-134-137
    Average 99 stars, based on 1 article reviews
    cell lines hek293 atcc crl - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    ATCC cell lines hek293 cell line atcc crl
    Cell Lines Hek293 Cell Line Atcc Crl, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+human+hek293+atcc+crl/293T%2F17%3B+Embryonic+Kidney%3B+Human/pm41223857-557-207-212
    Average 99 stars, based on 1 article reviews
    cell lines hek293 cell line atcc crl - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    95
    ATCC hek293 human embryonic kidney cell lines
    Hek293 Human Embryonic Kidney Cell Lines, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+human+hek293+atcc+crl/HEK+293+STF%3B+Embryonic+Kidney%3B+Human/bio_rxiv__2025__11__07__686998-184-21-30
    Average 95 stars, based on 1 article reviews
    hek293 human embryonic kidney cell lines - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    Image Search Results